Skip to Content

Does God exist?


'Does God exist?'

Sometimes people say 'Prove to me that God exists' to which the reply is usually, 'What sort of proof would you be willing to accept?'

 

“Does God exist?”

 

Sometimes people say “Prove to me that God exists” to which the reply is usually, “What sort of proof would you be willing to accept?”

 

I’m certain, for example, that my wife Julia loves me. If we’re looking for mathematical proof, the sort of proof you get when you do a repeatable experiment, then I’m afraid you’re going to be disappointed because you can’t put Julia’s love in a test tube anymore than you can put God’s existence in a test tube. There are some truths that don’t lend themselves to scientific experiments.

 

Just for now, let’s imagine that Christianity doesn’t exist and ask are there any other good reasons to think that God exists?

 

I want to suggest 2 very strong reasons for thinking that God exists.

 

And the first of them is this . . .

 

  1.  “God” is the most likely explanation for the existence of the universe.

 

Einstein argued that the universe is expanding; American astronomer, Edwin Hubble, confirmed this.

So seeing as the universe is expanding, in the past it must have been much smaller than it is today. That’s why everyone now believes that at one time, the universe must have had a beginning.

 

Also, in 1965 we discovered some background radiation in the universe that looks like it was left behind by this “beginning” moment, or what’s popularly called the Big Bang.

 

The theory starts like this: Once upon a time, all the matter that currently exists in the universe was condensed and compressed into one tiny particle smaller than a grain of sand.

 

Incidentally: “Why should such a phenomenal particle exist?” Atheism has no answer.

 

Then the theory says that there was something called a quantum fluctuation, which caused this particle to explode outwards.

 

Again we want to ask “Why should something as complicated as quantum mechanics go to all the bother of existing?” Again atheism has no answer.

 

Anyway, there’s this incredibly unlikely explosion, which causes all the matter to fly outwards, but at a perfectly controlled speed.

 

So the universe expands, but the speed of expansion turns out to be critical. If slowed down too much the universe would collapse back on itself. But in fact, we find that it’s got just enough juice to carry on expanding forever. Which just happens to be what’s needed. How very convenient!

 

Stephen Hawking, author of “A Brief History of Time” admits “If the rate of expansion one second after the big bang had been smaller by even one part in a hundred thousand million million, the universe would have re-collapsed before it ever reached it’s present size.”

 

All these are signs and wonders, so precisely finely tuned that it looks like evidence of intelligent design.

 

Roger Penrose who worked with Stephen Hawking to develop our current understanding of black holes, computed the odds of the Big Bang producing by accident our ordered universe as one in 10 to the power of 10 to the power of 123. In other words a number that has more zeros on the end of it than the total number of particles in the entire universe.

 

Unsurprisingly, a lot of physicists don’t want to believe in something so extraordinarily unlikely.

 

Stephen Hawking, summarizing says: “It would be very difficult to explain why the universe should have begun this way, except as an act of a God who intended to create beings like us.”

 

2. “God” is the most likely explanation for the existence of the first living organism on earth.

 

 People talk about the development of life by chance as if it was inevitable, as if it was bound to happen. Nothing could be farther from the truth!

 

The gap between non-living rocks and living organisms is the biggest and most profound divide in all of nature. There is a world of difference between the most complex non-living system, such as a snowflake, and even the most basic or primitive living cell.

 

Even if you got all the basic building blocks of life in place and put them into the ideal conditions, the chances of getting a living cell to come into existence are practically zero.

 

There are two huge problems here for atheism, which I'll touch on now, but which I explain in more detail in my book Aftershock:

 

a) Could the first cell have been constructed by chance?

 

1. The first problem is that actually building the first ever cell is phenomenally complex. A cell under a microscope looks like a high-tech factory. The creation of the even the most basic primitive, first-ever cell still involves amino acids just magically existing then forming proteins to create life in a way that at present we can’t really imagine.

 

Why should amino acids just magically come into existence? You’d then have to isolate the 20 amino acids which are usable for making proteins. Then you’d have to go through them one by one, picking out only the left handed ones. Then you’d have to assemble the amino acids in exactly the right sequence and join them to special peptide bonds that fold three-dimensionally, and if you hit the jackpot and got 100 amino acids in the right sequence, you still wouldn’t have life – you’d only have one protein. You’d need maybe another 200 or so proteins to even have the first sniff of a chance of life.

 

This is a huge problem for atheism.

 

So, you might ask, ‘If proteins couldn’t have been assembled by chance, how are they assembled?’

 

The answer is that they’re assembled by the greatest marvel in the whole of nature, a living code called DNA.

 

b) What is the origin of DNA?

 

2. And the origin of DNA is the second and biggest problem for atheism.

 

The DNA code tells the amino acids to arrange themselves in a special sequence. And a longer stretch of code is called a gene.

 

Here’s how it works. Let’s imagine I use my mobile phone right now to text you a genetic code.

 

It might look like this:

 

AGGTTCTCCCAAGAGGTTCTCCCAAAG

 

And you would think that’s rubbish. But let me send you another message.

 

MAKE HIS NOSE LIKE BRAD PITT’S NOSE

 

Now you can understand this message because I communicated in a code called the English Language. I assumed that you could read this code. I assumed that you knew what a nose is, and who Brad Pitt is. Now the previous message made up of A G Ts and Cs was doing exactly the same. The difference is that your body understands the AGTC code. In fact there’s a film star in Hollywood who’s carrying that message right now.

 

But where did the DNA code come from in the first ever living cell? Where did the code and the means of translating it come from? They’re both needed from the word go. One’s useless without the other.

 

The point is that information-rich messages which can reproduce life don’t just happen.

 

When DNA arrives on the scene, it’s an instruction book. That looks suspiciously like forward planning! So where did the first DNA code come from in the first ever living cell?

 

It must have come from an intelligent source that existed before anything else did. The word we have for a pre-existent intelligent being in the English language is “God”.

 

So to re-cap, DNA is an information code. It can be written down in letters. It’s an intelligent message. And it exists inside the cell. It has to exist for the cell to work and reproduce itself. Which begs the question, where did the information come from in the first cell? The information is written in a code, so the code and the means of translating it have to come into existence at the same time. This is a massive problem for atheism.

 

Let’s use this analogy: Here is a book. I’d like to give you two alternative scenarios as to how this book came into existence, and I’d like you to give me your best guess as to which of these two is the more likely scenario.

 

This book came about as a result of either:

 

  1. Intelligent design by an author who intended to create the message, or
  2. It’s the result of a tornado, who blew through a printing factory, causing bits of paper and ink to fly up into the air and it just so happened that the bits of paper fell by chance in such as way as to form a book and the ink landed on all 250 pages by pure chance in such a way as to accidentally communicate a distinct and ordered message.

 

Which of those do you think is more likely?

 

I find that only those with a prior commitment to atheism would bet on the tornado. You see DNA is information. In fact, information powerful and complex enough to reproduce life. Information has to come from somewhere.

 

Francis Crick, the man who won the Nobel Prize for discovering the structure of DNA in 1953 has said that there is literally zero probability of life coming into existence out of nothing by chance.

 

It’s been said by some that Francis Crick understands the complexity of life on this planet better than anyone else.

 

And Francis Crick knows DNA can’t just happen on earth, but he’s an atheist. So how did DNA get here? His totally serious answer is . . . wait for it: Space ships! He says DNA arrived billions of years ago in a space ship sent to earth by aliens. That’s right: A space ship.

 

The man who discovered DNA’s structure, Sir Francis Crick honestly suggests that seeing as life could never have come into existence on this planet by chance, it must have been transported here by intelligent life from elsewhere in the galaxy by space ship. He says in his book ‘Life Itself’: “micro-organisms travelled in the head of an unmanned spaceship sent to earth by a higher civilization which developed elsewhere billions of years ago.”

 

Now I suggest, he hasn’t solved the problem, he’s simply moved it to the planet Krypton. It is beginning to look as if people like Crick will go to any lengths to avoid having to admit that something as complex as DNA, must have been made by God.

 

On the two points I’ve made, the fair minded enquirer will find that all the evidence is currently pointing away from chance theories and towards Intelligent Design.

 

Now none of what we’ve looked at proves that God exists, but it does leave us thinking that God’s existence is the best available explanation for both the existence of the universe and the existence of life.

 

So when we look at the life of Jesus, rather than it just being a slightly bizarre departure into ancient history, we could almost begin by thinking. ‘If God exists, and it looks like he probably does, and he went to all this trouble to create the universe, and organic life, then wouldn’t it make sense for him to reveal himself to his creatures at some point in history?’

 

All Christianity is saying is that God has revealed himself at one particular point in history, around 2010 years ago.

 

There’s a reason why God went to all the trouble of creating the universe and creating living things, it’s because he wants you and I to exist. He wants a love relationship with us.

 

Problem is we’ve all done stuff wrong. What the bible calls sin, so all of us get cut off from God.

 

The result or the punishment for sin is death.

 

But God so loved you, that he sent Jesus to die instead of you.

 

So, Christianity says, we deserve death, we’re facing death, but God loves us so much he sends Jesus to die instead of us.

 

So Jesus dies on the cross in our place. Bad news for Jesus.

 

But good news for us, because now the barrier of sin is removed and we can now enter into the relationship with God, which we were created for.

 

Click here to hear the full talk.


Post new comment

  • Web page addresses and e-mail addresses turn into links automatically.
  • Allowed HTML tags: <a> <em> <strong> <cite> <code> <ul> <ol> <li> <dl> <dt> <dd>
  • Lines and paragraphs break automatically.
  • Twitter-style @usersnames are linked to their Twitter account pages.
  • Twitter-style #hashtags are linked to search.twitter.com.

More information about formatting options